The androgen receptor is transcriptionally suppressed by proteins that bind single-stranded DNA

M. E. Grossmann, D. J. Tindall

Research output: Contribution to journalArticle

33 Citations (Scopus)

Abstract

The androgen receptor (AR) is a nuclear transcription factor that is essential for development of the male urogenital tract. In the current work, we have characterized the mouse androgen receptor suppressor (mARS). A single, 20-base pair, region (TCCCCCCACCCACCCCCCCT) was sufficient for suppression in chloramphenicol acetyltransferase assays. Northern analysis indicated that translational regulation is not necessary for the suppression. Analysis of the AR mRNA half-life indicated that the mARS does not affect AR RNA degradation. Gel mobility assays showed that the mARS is bound by multiple proteins that can recognize single-stranded DNA and RNA. In addition, differing proteins are expressed in distinct tissues. Purification of some of these proteins has shown that a doublet of 33 and 35 kDa binds to the G-rich strand and that a 52-kDa protein binds to the C-rich strand. Southwestern blots have confirmed that these proteins are indeed recognized by the mARS. The results of these experiments indicate that the AR 5'- untranslated region contains a suppressor element that can be bound by multiple proteins. The mARS appears to be acting either by altering transcription initiation or blocking transcription elongation. Characterization of this suppressor may provide insight into the physiological means by which the AR is regulated.

Original languageEnglish (US)
Pages (from-to)10968-10975
Number of pages8
JournalJournal of Biological Chemistry
Volume270
Issue number18
DOIs
StatePublished - 1995

Fingerprint

Single-Stranded DNA
Androgen Receptors
Proteins
Southwestern Blotting
Transcription
Chloramphenicol O-Acetyltransferase
5' Untranslated Regions
RNA Stability
Assays
Base Pairing
Half-Life
RNA
Transcription Factors
Gels
mouse AR protein
Messenger RNA
Purification
Elongation
Tissue
Degradation

ASJC Scopus subject areas

  • Biochemistry

Cite this

The androgen receptor is transcriptionally suppressed by proteins that bind single-stranded DNA. / Grossmann, M. E.; Tindall, D. J.

In: Journal of Biological Chemistry, Vol. 270, No. 18, 1995, p. 10968-10975.

Research output: Contribution to journalArticle

Grossmann, M. E. ; Tindall, D. J. / The androgen receptor is transcriptionally suppressed by proteins that bind single-stranded DNA. In: Journal of Biological Chemistry. 1995 ; Vol. 270, No. 18. pp. 10968-10975.
@article{3324315f20b1438cb6606584f56f3591,
title = "The androgen receptor is transcriptionally suppressed by proteins that bind single-stranded DNA",
abstract = "The androgen receptor (AR) is a nuclear transcription factor that is essential for development of the male urogenital tract. In the current work, we have characterized the mouse androgen receptor suppressor (mARS). A single, 20-base pair, region (TCCCCCCACCCACCCCCCCT) was sufficient for suppression in chloramphenicol acetyltransferase assays. Northern analysis indicated that translational regulation is not necessary for the suppression. Analysis of the AR mRNA half-life indicated that the mARS does not affect AR RNA degradation. Gel mobility assays showed that the mARS is bound by multiple proteins that can recognize single-stranded DNA and RNA. In addition, differing proteins are expressed in distinct tissues. Purification of some of these proteins has shown that a doublet of 33 and 35 kDa binds to the G-rich strand and that a 52-kDa protein binds to the C-rich strand. Southwestern blots have confirmed that these proteins are indeed recognized by the mARS. The results of these experiments indicate that the AR 5'- untranslated region contains a suppressor element that can be bound by multiple proteins. The mARS appears to be acting either by altering transcription initiation or blocking transcription elongation. Characterization of this suppressor may provide insight into the physiological means by which the AR is regulated.",
author = "Grossmann, {M. E.} and Tindall, {D. J.}",
year = "1995",
doi = "10.1074/jbc.270.18.10968",
language = "English (US)",
volume = "270",
pages = "10968--10975",
journal = "Journal of Biological Chemistry",
issn = "0021-9258",
publisher = "American Society for Biochemistry and Molecular Biology Inc.",
number = "18",

}

TY - JOUR

T1 - The androgen receptor is transcriptionally suppressed by proteins that bind single-stranded DNA

AU - Grossmann, M. E.

AU - Tindall, D. J.

PY - 1995

Y1 - 1995

N2 - The androgen receptor (AR) is a nuclear transcription factor that is essential for development of the male urogenital tract. In the current work, we have characterized the mouse androgen receptor suppressor (mARS). A single, 20-base pair, region (TCCCCCCACCCACCCCCCCT) was sufficient for suppression in chloramphenicol acetyltransferase assays. Northern analysis indicated that translational regulation is not necessary for the suppression. Analysis of the AR mRNA half-life indicated that the mARS does not affect AR RNA degradation. Gel mobility assays showed that the mARS is bound by multiple proteins that can recognize single-stranded DNA and RNA. In addition, differing proteins are expressed in distinct tissues. Purification of some of these proteins has shown that a doublet of 33 and 35 kDa binds to the G-rich strand and that a 52-kDa protein binds to the C-rich strand. Southwestern blots have confirmed that these proteins are indeed recognized by the mARS. The results of these experiments indicate that the AR 5'- untranslated region contains a suppressor element that can be bound by multiple proteins. The mARS appears to be acting either by altering transcription initiation or blocking transcription elongation. Characterization of this suppressor may provide insight into the physiological means by which the AR is regulated.

AB - The androgen receptor (AR) is a nuclear transcription factor that is essential for development of the male urogenital tract. In the current work, we have characterized the mouse androgen receptor suppressor (mARS). A single, 20-base pair, region (TCCCCCCACCCACCCCCCCT) was sufficient for suppression in chloramphenicol acetyltransferase assays. Northern analysis indicated that translational regulation is not necessary for the suppression. Analysis of the AR mRNA half-life indicated that the mARS does not affect AR RNA degradation. Gel mobility assays showed that the mARS is bound by multiple proteins that can recognize single-stranded DNA and RNA. In addition, differing proteins are expressed in distinct tissues. Purification of some of these proteins has shown that a doublet of 33 and 35 kDa binds to the G-rich strand and that a 52-kDa protein binds to the C-rich strand. Southwestern blots have confirmed that these proteins are indeed recognized by the mARS. The results of these experiments indicate that the AR 5'- untranslated region contains a suppressor element that can be bound by multiple proteins. The mARS appears to be acting either by altering transcription initiation or blocking transcription elongation. Characterization of this suppressor may provide insight into the physiological means by which the AR is regulated.

UR - http://www.scopus.com/inward/record.url?scp=0028935968&partnerID=8YFLogxK

UR - http://www.scopus.com/inward/citedby.url?scp=0028935968&partnerID=8YFLogxK

U2 - 10.1074/jbc.270.18.10968

DO - 10.1074/jbc.270.18.10968

M3 - Article

C2 - 7738038

AN - SCOPUS:0028935968

VL - 270

SP - 10968

EP - 10975

JO - Journal of Biological Chemistry

JF - Journal of Biological Chemistry

SN - 0021-9258

IS - 18

ER -