The androgen receptor is transcriptionally suppressed by proteins that bind single-stranded DNA

The androgen receptor (AR) is a nuclear transcription factor that is essential for development of the male urogenital tract. In the current work, we have characterized the mouse androgen receptor suppressor (mARS). A single, 20-base pair, region (TCCCCCCACCCACCCCCCCT) was sufficient for suppression in chloramphenicol acetyltransferase assays. Northern analysis indicated that translational regulation is not necessary for the suppression. Analysis of the AR mRNA half-life indicated that the mARS does not affect AR RNA degradation. Gel mobility assays showed that the mARS is bound by multiple proteins that can recognize single-stranded DNA and RNA. In addition, differing proteins are expressed in distinct tissues. Purification of some of these proteins has shown that a doublet of 33 and 35 kDa binds to the G-rich strand and that a 52-kDa protein binds to the C-rich strand. Southwestern blots have confirmed that these proteins are indeed recognized by the mARS. The results of these experiments indicate that the AR 5'- untranslated region contains a suppressor element that can be bound by multiple proteins. The mARS appears to be acting either by altering transcription initiation or blocking transcription elongation. Characterization of this suppressor may provide insight into the physiological means by which the AR is regulated.