TY - JOUR
T1 - Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children
AU - Ovsyannikova, Inna G.
AU - Salk, Hannah M.
AU - Larrabee, Beth R.
AU - Pankratz, V. Shane
AU - Poland, Gregory A.
N1 - Publisher Copyright:
© 2015, Springer-Verlag Berlin Heidelberg.
Copyright:
Copyright 2017 Elsevier B.V., All rights reserved.
PY - 2015/10/26
Y1 - 2015/10/26
N2 - The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.
AB - The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.
KW - Cytokines
KW - Genetic association
KW - Neutralizing antibodies
KW - Rubella vaccine
KW - Single nucleotide polymorphisms (SNPs)
UR - http://www.scopus.com/inward/record.url?scp=84942191318&partnerID=8YFLogxK
UR - http://www.scopus.com/inward/citedby.url?scp=84942191318&partnerID=8YFLogxK
U2 - 10.1007/s00251-015-0864-z
DO - 10.1007/s00251-015-0864-z
M3 - Article
C2 - 26329766
AN - SCOPUS:84942191318
VL - 67
SP - 547
EP - 561
JO - Immunogenetics
JF - Immunogenetics
SN - 0093-7711
IS - 10
ER -