Erratum: Prolonged use of a proton pump inhibitor reduces microbial diversity: Implications for Clostridium difficile susceptibility [Microbiome, 4, (2016): 10]. DOI 10.1186/s40168-016-0158-1

Charlie T. Seto, Patricio Jeraldo, Robert Orenstein, Nicholas D Chia, John K. DiBaise

Research output: Contribution to journalComment/debate

1 Scopus citations


After publication of this article [1], an error was reported in the 'Methods' section of the article under the subheading 'DNA extraction and library preparation'. The second primer associated with 926R was incorrectly stated as: "CAAGCAGAAGACGGCATACGA GATGCCGCATTCGATXXXXXXXXXXXXCCGTCAA TTCMTTTRAGT". The correct sequence for the experimental work was: "CAAGCAGAAGACGGCA TACGAGAT NNNNNNNNNNNN AGTCAGTCAG CC CCGTCAATTCMTTTRAGT".

Original languageEnglish (US)
Article number10
StatePublished - 2016


ASJC Scopus subject areas

  • Microbiology
  • Microbiology (medical)

Cite this