Erratum: Prolonged use of a proton pump inhibitor reduces microbial diversity: Implications for Clostridium difficile susceptibility [Microbiome, 4, (2016): 10]. DOI 10.1186/s40168-016-0158-1

Charlie T. Seto, Patricio Jeraldo, Robert Orenstein, Nicholas D Chia, John K. DiBaise

Research output: Contribution to journalComment/debate

1 Citation (Scopus)

Abstract

After publication of this article [1], an error was reported in the 'Methods' section of the article under the subheading 'DNA extraction and library preparation'. The second primer associated with 926R was incorrectly stated as: "CAAGCAGAAGACGGCATACGA GATGCCGCATTCGATXXXXXXXXXXXXCCGTCAA TTCMTTTRAGT". The correct sequence for the experimental work was: "CAAGCAGAAGACGGCA TACGAGAT NNNNNNNNNNNN AGTCAGTCAG CC CCGTCAATTCMTTTRAGT".

Original languageEnglish (US)
Article number10
JournalMicrobiome
Volume4
DOIs
StatePublished - 2016

Fingerprint

Clostridium difficile
Proton Pump Inhibitors
Microbiota
Gene Library
Publications

ASJC Scopus subject areas

  • Microbiology
  • Microbiology (medical)

Cite this

Erratum : Prolonged use of a proton pump inhibitor reduces microbial diversity: Implications for Clostridium difficile susceptibility [Microbiome, 4, (2016): 10]. DOI 10.1186/s40168-016-0158-1. / Seto, Charlie T.; Jeraldo, Patricio; Orenstein, Robert; Chia, Nicholas D; DiBaise, John K.

In: Microbiome, Vol. 4, 10, 2016.

Research output: Contribution to journalComment/debate

@article{4c23b97ba44b417ab05a9c4f42d4f799,
title = "Erratum: Prolonged use of a proton pump inhibitor reduces microbial diversity: Implications for Clostridium difficile susceptibility [Microbiome, 4, (2016): 10]. DOI 10.1186/s40168-016-0158-1",
abstract = "After publication of this article [1], an error was reported in the 'Methods' section of the article under the subheading 'DNA extraction and library preparation'. The second primer associated with 926R was incorrectly stated as: {"}CAAGCAGAAGACGGCATACGA GATGCCGCATTCGATXXXXXXXXXXXXCCGTCAA TTCMTTTRAGT{"}. The correct sequence for the experimental work was: {"}CAAGCAGAAGACGGCA TACGAGAT NNNNNNNNNNNN AGTCAGTCAG CC CCGTCAATTCMTTTRAGT{"}.",
author = "Seto, {Charlie T.} and Patricio Jeraldo and Robert Orenstein and Chia, {Nicholas D} and DiBaise, {John K.}",
year = "2016",
doi = "10.1186/s40168-016-0158-1",
language = "English (US)",
volume = "4",
journal = "Microbiome",
issn = "2049-2618",
publisher = "BioMed Central",

}

TY - JOUR

T1 - Erratum

T2 - Prolonged use of a proton pump inhibitor reduces microbial diversity: Implications for Clostridium difficile susceptibility [Microbiome, 4, (2016): 10]. DOI 10.1186/s40168-016-0158-1

AU - Seto, Charlie T.

AU - Jeraldo, Patricio

AU - Orenstein, Robert

AU - Chia, Nicholas D

AU - DiBaise, John K.

PY - 2016

Y1 - 2016

N2 - After publication of this article [1], an error was reported in the 'Methods' section of the article under the subheading 'DNA extraction and library preparation'. The second primer associated with 926R was incorrectly stated as: "CAAGCAGAAGACGGCATACGA GATGCCGCATTCGATXXXXXXXXXXXXCCGTCAA TTCMTTTRAGT". The correct sequence for the experimental work was: "CAAGCAGAAGACGGCA TACGAGAT NNNNNNNNNNNN AGTCAGTCAG CC CCGTCAATTCMTTTRAGT".

AB - After publication of this article [1], an error was reported in the 'Methods' section of the article under the subheading 'DNA extraction and library preparation'. The second primer associated with 926R was incorrectly stated as: "CAAGCAGAAGACGGCATACGA GATGCCGCATTCGATXXXXXXXXXXXXCCGTCAA TTCMTTTRAGT". The correct sequence for the experimental work was: "CAAGCAGAAGACGGCA TACGAGAT NNNNNNNNNNNN AGTCAGTCAG CC CCGTCAATTCMTTTRAGT".

UR - http://www.scopus.com/inward/record.url?scp=84996590237&partnerID=8YFLogxK

UR - http://www.scopus.com/inward/citedby.url?scp=84996590237&partnerID=8YFLogxK

U2 - 10.1186/s40168-016-0158-1

DO - 10.1186/s40168-016-0158-1

M3 - Comment/debate

AN - SCOPUS:84996590237

VL - 4

JO - Microbiome

JF - Microbiome

SN - 2049-2618

M1 - 10

ER -