Erratum: Prolonged use of a proton pump inhibitor reduces microbial diversity: Implications for Clostridium difficile susceptibility [Microbiome, 4, (2016): 10]. DOI 10.1186/s40168-016-0158-1

Charlie T. Seto; Patricio Jeraldo; Robert Orenstein; Nicholas Chia; John K. DiBaise

doi:10.1186/s40168-016-0158-1

Erratum: Prolonged use of a proton pump inhibitor reduces microbial diversity: Implications for Clostridium difficile susceptibility [Microbiome, 4, (2016): 10]. DOI 10.1186/s40168-016-0158-1

Charlie T. Seto, Patricio Jeraldo, Robert Orenstein, Nicholas Chia, John K. DiBaise

Research output: Contribution to journal › Comment/debate › peer-review

1 Scopus citations

Abstract

After publication of this article [1], an error was reported in the 'Methods' section of the article under the subheading 'DNA extraction and library preparation'. The second primer associated with 926R was incorrectly stated as: "CAAGCAGAAGACGGCATACGA GATGCCGCATTCGATXXXXXXXXXXXXCCGTCAA TTCMTTTRAGT". The correct sequence for the experimental work was: "CAAGCAGAAGACGGCA TACGAGAT NNNNNNNNNNNN AGTCAGTCAG CC CCGTCAATTCMTTTRAGT".

Original language	English (US)
Article number	10
Journal	Microbiome
Volume	4
DOIs	https://doi.org/10.1186/s40168-016-0158-1
State	Published - 2016

ASJC Scopus subject areas

Microbiology
Microbiology (medical)

Access to Document

10.1186/s40168-016-0158-1

Cite this

@article{4c23b97ba44b417ab05a9c4f42d4f799,

title = "Erratum: Prolonged use of a proton pump inhibitor reduces microbial diversity: Implications for Clostridium difficile susceptibility [Microbiome, 4, (2016): 10]. DOI 10.1186/s40168-016-0158-1",

abstract = "After publication of this article [1], an error was reported in the 'Methods' section of the article under the subheading 'DNA extraction and library preparation'. The second primer associated with 926R was incorrectly stated as: {"}CAAGCAGAAGACGGCATACGA GATGCCGCATTCGATXXXXXXXXXXXXCCGTCAA TTCMTTTRAGT{"}. The correct sequence for the experimental work was: {"}CAAGCAGAAGACGGCA TACGAGAT NNNNNNNNNNNN AGTCAGTCAG CC CCGTCAATTCMTTTRAGT{"}.",

author = "Seto, {Charlie T.} and Patricio Jeraldo and Robert Orenstein and Nicholas Chia and DiBaise, {John K.}",

note = "Publisher Copyright: {\textcopyright} 2016 Seto et al.",

year = "2016",

doi = "10.1186/s40168-016-0158-1",

language = "English (US)",

volume = "4",

journal = "Microbiome",

issn = "2049-2618",

publisher = "BioMed Central",

}

TY - JOUR

T1 - Erratum

T2 - Prolonged use of a proton pump inhibitor reduces microbial diversity: Implications for Clostridium difficile susceptibility [Microbiome, 4, (2016): 10]. DOI 10.1186/s40168-016-0158-1

AU - Seto, Charlie T.

AU - Jeraldo, Patricio

AU - Orenstein, Robert

AU - Chia, Nicholas

AU - DiBaise, John K.

PY - 2016

Y1 - 2016

N2 - After publication of this article [1], an error was reported in the 'Methods' section of the article under the subheading 'DNA extraction and library preparation'. The second primer associated with 926R was incorrectly stated as: "CAAGCAGAAGACGGCATACGA GATGCCGCATTCGATXXXXXXXXXXXXCCGTCAA TTCMTTTRAGT". The correct sequence for the experimental work was: "CAAGCAGAAGACGGCA TACGAGAT NNNNNNNNNNNN AGTCAGTCAG CC CCGTCAATTCMTTTRAGT".

AB - After publication of this article [1], an error was reported in the 'Methods' section of the article under the subheading 'DNA extraction and library preparation'. The second primer associated with 926R was incorrectly stated as: "CAAGCAGAAGACGGCATACGA GATGCCGCATTCGATXXXXXXXXXXXXCCGTCAA TTCMTTTRAGT". The correct sequence for the experimental work was: "CAAGCAGAAGACGGCA TACGAGAT NNNNNNNNNNNN AGTCAGTCAG CC CCGTCAATTCMTTTRAGT".

UR - http://www.scopus.com/inward/record.url?scp=84996590237&partnerID=8YFLogxK

UR - http://www.scopus.com/inward/citedby.url?scp=84996590237&partnerID=8YFLogxK

U2 - 10.1186/s40168-016-0158-1

DO - 10.1186/s40168-016-0158-1

M3 - Comment/debate

AN - SCOPUS:84996590237

SN - 2049-2618

VL - 4

JO - Microbiome

JF - Microbiome

M1 - 10

ER -

Erratum: Prolonged use of a proton pump inhibitor reduces microbial diversity: Implications for Clostridium difficile susceptibility [Microbiome, 4, (2016): 10]. DOI 10.1186/s40168-016-0158-1

Abstract

ASJC Scopus subject areas

Access to Document

Other files and links

Fingerprint

Cite this